Com

To handle the operation on 2D polygons, I recently needed a set of libraries or libraries. I need to be able to perform boolean / clipping operations (difference and association) and triangular. So far I have found that there are libraries, and polytry looks good for triangular but I'm still leaving the boolean operation, and I'm not sure about its maturation. CAGL and GPC are free only if my own project is free. My special project is not commercial, so I am not hesitant to pay or request any license but I will be able to make a future commercial project I would like to use my code for this, so I'm hesitant about CGAL's open source license and the freeware-only restriction of the GPC. Oh, and C / C ++ have been liked.

Greetings, Using the Facebook API, I received an out access token for a user Have done I can use it to get information about the user and post on his wall etc. I'm trying to explain that (or if there is any way) get a list of pages of a user in a programmatic manner (so that they can be presented in a drop-down list on a third-party site) No such method has been found in the Facebook API, but I hope I remember something. Thank you! Since this question was asked, Facebook has added a new connection to the "user" graph API object : accounts . The current user-owned Facebook page, if manage_pages are allowed, this connection also uses access_tokens, which can be used for the graph API query from the page. .

I have a list of arrays and I would like to get the cartesian product of elements in the array. I would use an example to make it more solid ... itertools.product wants to do the trick, but I'm stuck in a little detail. arrays = [((-1, + 1), (-2, + 2), (-3, + 3)]; If I do cp = list (itertools.product (arrays)); get me cp = Cp0 = [((-1, 1)), ((-2, 2)), ((-3, 3),)] But what do I have to do? / P> cp1 = [(-1, -2, -3), (-1, -2, +3), (-1, + 2, -3), (-1, + 2, + 3), ..., (+ 1, + 2, -3), (+ 1, 2, 3)]. I have tried a few different things: cp = list (itertools.product (itertools.islice (arrays, lanes (arrays))) ); Cp = list (itertools.product (arrays, lanes (arrays))); All of them gave me cp0 instead of cp1 . Any thoughts? Thanks in advance. & gt; & Gt; & Gt; List (Iterols.product (* array)) [(-1, -2, -3), (-1, -2, 3), (-1, 2, -3), (-1, 2, 3) , (1, -2, -3), (1, -2, 3), (1, 2, -3), (1, 2, 3)] Feed all the arguments in the pro

दो मॉडल (रेल 2.3.8): उपयोगकर्ता; उपयोगकर्ता नाम & amp; अक्षम गुण; उपयोगकर्ता के पास है: प्रोफ़ाइल प्रोफ़ाइल; पूर्ण_नाव & amp; छिपी हुई संपत्तियों मैं नामित_स्स्कोप बनाने की कोशिश कर रहा हूं जो अक्षम = 1 और छिपा हुआ = 1 उपयोगकर्ता-प्रोफाइल को समाप्त कर रहा है। प्रयोक्ता मॉडल आमतौर पर प्रोफाइल मॉडल के संयोजन के रूप में उपयोग किया जाता है, इसलिए मैं प्रोफ़ाइल मॉडल ((इसमें शामिल =>: प्रोफ़ाइल) को उत्सुक-लोड करने का प्रयास करता हूं। मैंने एक उपयोगकर्ता नाम पर नामित_स्स्कोप को 'दृश्यमान' बनाया ': नामित_स्स्कोप: दृश्यमान, {: joins = & gt; "INNER यूज़र्स.आईडी = प्रोफाइल.युसर_आईडी पर शामिल हों",: conditions = & gt; ["Users.disabled =? And profiles.hidden =?", False, false]} मैंने देखा है कि जब मैं एक क्वेरी में name_scope का उपयोग करता हूं, उत्सुक लोडिंग निर्देश विविधता 1 - उपयोगकर्ता मॉडल केवल: # UserController @users = User.find (: सभी) # उपयोगकर्ता के लिए इंडेक्स दृश्य & lt;% @ उपयोगकर्ता% & gt; & Lt; p &

When I am grabbing data from my table for which permission is required, then all permissions should be made there ? Such as checking an administrator or seeing those data (MySQL)? Or should I catch it if they have a record, then check the specific actions on the PHP side (like see, add, edit, delete)? This is usually more efficient to do everything in SQL, but it is even more complex, And it can be very difficult to maintain. Mostly it depends on your exact safety model and safety concerns.

I have defined a class that does a long job and I call it to many other classes. Now I want to show an activity indicator, while this work is talking about it, and then it is removed. Since this is just a boring background task, this class has no visual, and I think that where I go into my problem. I can not get to show this thing That is what I did in my class: UIActivityIndicatorView * Activity indicator = [[UIActivityIndicatorView alloc] initWithFrame: CGRectMake 0.0F, 0.0F, 32.0F, 32.0 F)]; [Activity indicator set center: CGPointMake (160.0f, 208.0F)]; Activity indicator. Activation indicator = UIActivityIndicatorViewStyleWhite; UIView * contentView = [[UIView alloc] initWithFrame: [[UIScreen main screen] ApplicationFrame]]; [ContentView addSubview: Activity indicator]; [ActivityInteractive start-up]; // Class is long work that takes several seconds ..... [contentView release]; [Activity indicator release]; I think that when I get the content view, then I do something w

I have a scenario where I need user checkout via PayPal and once we receive payment So we subscribe, the record PayPal in our membership site requires a "return" field when you submit the form button that will take the user back to our page, when the order will be successfully processed. On that page, we actually track sales and set a part of JavaScript to track sales. So my question is, how can I make sure that the Return page comes from PayPal and this is not a fraud. In the system, I know by user that in order to post PayPal back to our system There is a way to use notify_url, but in this case I have a simple way of doing this to run a part of JavaScript, or I need to write some looping / timetable functions which will be seen Checks to see if the post has been informed? I have to post to PayPal To prevent spoofing, call PayPal on a script on your site Will happen. Any changes made through the client / browser are open to modify the user, so only PayPal is dir

From your experience, what is the most flexible minimizer / compressor (JS + CSS) for ASP.NET MVC So far MVC does not seem too good Not the documentation still Seems like a good candidate, but have not tried it yet combines and compresses javascript only, but not css Resilience to mine Means Choose whether to be compressed, minified and combined Add an exception like if the debug does not contain XYZ.JS or weakens ABC. CSS Caching Finally, it should help provide the best YSLOW score. If you know any other sect, then list them as well. Dependency on the client is no longer in beta and works well with MVC, I think That's it's a very good candidate. AFAIK does not use YUI but you can plug your compressor.

"postprint" itemprop = "text"> I get the error message ... I'm getting the value in success by using ajax: function (msgqq) This is where my ajax want to get some other answer then how to get past: I want success: function (msgqq) < P> success: function (msg) this is my ajax function UserNameAvailablity (InP) { $ .ajax ({type: "GET", URL: "& lt; = base_url ()> /system/application/views/ssitAjax.php", Cai : False, data: "? TxtUserName =" + inp, success: function (msgqq) {document.getElementById ('showErrmessage') innerHTML = msgqq ;. $ ("# showErrmessage") HTML (msgqq); if (txtUserName. Value == "") {document.getElementById ('txtUserName') focus () ;. document.getElementById ('TxtUserName'). Value = "";}}}); } "itemprop =" text "> after you If you want another response then you need to perform an additional request Will h

We are interested in finding some statistics on different frameworks Very low (low, medium, high) + average number of emails per day | every month. Number of releases made in one year, including patches, minor, major releases. We looked at the Mewen repositories, but it was not very helpful. We looked, but did not find the desired information. Any ideas to get this information (any Maven-2 plugin)? The list activity on mailing recharges is very low (low, medium, high) + average Number of emails per day | every month. You will find these information (but also for other lists). The number of releases made in one year, including patches, minor, major releases, we saw the Mewen repositories, but it was not very useful. I will use cumin for this.

Usually you can log in to sites that need the HTTP Basic Authentication by passing the username and password to the URL Such as: Any idea why it will work with other browsers, but not with Firefox? Peter I have found it now, the problem was that FF < / P> http: // myusername: Myuserpassword@mydomain.com/mypath and http: // myusername: Myuserpassword@mydomain.com/mypath/ at the end of the URL "/" note. The first URL does not work with login, it now works with the other URL.

I have two related tables in a many to many relationship: Role and allow . The join table is RolePermission . role is a list of permission to object. It looks like: Private set & lt; Permission & gt; Permissions; @ManyToMany (speed = FetchType.EAGER, cascade = {CascadeType.ALL}) @JoinTable (name = "permission_role", joinColumns = @JoinColumn (name = "ROLE_ID"), inverseJoinColumns = @JoinColumn (name = "permission_id")) Public set & lt; ObjectPermission & gt; GetObjectPermissions () {Return Object Submissions; .} Adding a certain time I want to add permissions for a role: role.getObjectPermissions () (permission); RoleDAO.saveOrUpdate (role); Both roles and permissions are already present in DB, each in its table to add a record to the connection table, that will indicate both the role and the permissions: role.addObjectEntryPermissionRole (permission); RoleDAO.saveOrUpdate (role); The problem is that it seems t

During debug, I want to show the time taken to create pages for pages in the footer, server side. For example, if a page takes 250 mms server side then I would like to be displayed in the footer, in debug builds. How can I get it into the ASP.NET MVC project? Add it to the footer in your master page: < Code> Page Rendering took & lt;% = DateTime.Now.Subtract (this.ViewContext.HttpContext.Timestamp) Total EmyliseCand Toastring ()%> You can also wrap it in an extension method: public stable class extension {public static string RequestDurationinMs (This HtmlHelper Assistant) {#If Return Date DateTime.Now.Subtract (Assistant .ViewContext.HttpContext.Timestamp) TotalMilliseconds.ToString (); #endif}} Use this as: & lt;% = Html.RequestDurationinMs ()%> You may need to import the namespace of the extension class: & lt;% @ import namespace = "your namespace"% & gt;

I want to create a screen where I have to show the map with all available latitude and long time. And I want to show this map in 200 * 200 resolution. Can I make point bitmap focusing so that I can click on it and show another screen. Hope this link helps you solve your problem ; Do you have any ideas, when many points are selected, what did you talk about?

I searched here through several discussions, can anyone give me quick and direct answers? And if you can not update the batch with JPAs what will happen if I do not use the transaction, and only use the following flow: em = Emf.getEntityManager // Make some query / modify some data em.persist (..) // Make some query // modify some data em.persist (..) // Make some queries / modify some data .persist (..) ... em.close () How does it compare batch updates to performance, and compare it to A To commit transactions, to dumpster servers measured by RPC, CPU cycles per request, or to do so. Before each call em.persist (..) em.close () triggers an RPC call on the datastore server? Thanks for any feedback!

The Web Content Accessibility Guidelines states that you should provide a "skip" link that gives you an example (for example ) In the navigation block and content directly it is particularly useful for impaired users, who use a screen-reader to listen to a page. 6.2 Grouping and bypassing links However, this technique depends on using the name attribute anchor tags: Excluding the link: & lt; A href = "# content" & gt; Skip to content & lt; / A & gt; The problem is, the "name" attribute of the anchor tag is obsolete in HTML5 Footnote: Still the position of HTML5 in the draft and it is possible that What is the other way to achieve "Skip to" functionality without using this name feature? Actually the permission of the name trait will continue in this situation - although it will probably still generate a "warning", it is currently marked as "obsolete but customizable", which means that you c

मेरे मास्टर पेज में मेरे पास टेक्स्टबॉक्स है। & Lt; एएसपी: टेक्स्ट बॉक्स आईडी = "सर्च टेक्स्टबॉक्स" रन = "सर्वर" वर्ग = "खोज बॉक्स" onfocus = "छिपाएं खोज वॉटरमार्क ();" पाठ = "खोज" onblur = "ShowSearchWaterMark (this);" / & Gt; मैंने कोड के पीछे jquery संदर्भों को जोड़ दिया है। Textbox SearchTextBox = this.FindControl ("SearchTextBox") पाठ बॉक्स के रूप में; स्ट्रिंगबिल्डर ऑब्ज़ स्ट्रिंगबिइल्डर = नया स्ट्रिंगबिल्डर (); ObjStringBuilder.Append ("& lt; स्क्रिप्ट टाइप = \" टेक्स्ट / जावास्क्रिप्ट \ "भाषा = \" जावास्क्रिप्ट \ "& gt; \ n"); ObjStringBuilder.AppendFormat ("var searchTextBox = '{0}'; \ n", SearchTextBox.ClientID); objStringBuilder.Append ( "& lt; / स्क्रिप्ट & gt; \ n"); This.Page.ClientScript.RegisterClientScriptBlock (GetType (), "रजिस्टरVariables", objStringBuilder.ToString ()); यह। पृष्ठ। क्लाइंट

I have used git svn in my svn repository and there is an invalid character in the comment when I try to change the comment I get the following error: svn propedit -r 2958 --revprop svn: logs https: // svnhost / path / to / repository svn: valid UTF-8 data (hex : 68 6D 65 6 6 66 61 6 B 74 6 F 72 20 75 6 E64 20 4F 70 74 6 6 6 7 73 72 72) After the invalid UTF-8 sequence (HEEX: E4 6D69 65) > Does anyone have a tip that the business on the repository Without extensive rights and how to fix? I included questions by you change-log-msg The link is checked and you have to run commands and ignore the fact that they are listed that the repository is actually configured to allow log messages. Modifying is not a repository by default. Script pre-modified changes can be enabled to enable the modification of log messages, and it is done only by a person (usually the admin) with access to the file structure of the repository on the disk can go . It looks like you do not have th

How to do OpenGL on the Linux platform without the X-Window system, can I directly send OpenGL graphics to framebuffer devices? The project is a nominated DirectFB (Direct Framebuffer), we can do this with DirectFB, but DirectFB is available for every hardware I need a driver and I want a graphic card user who has only Linux driver. In this way I have expanded my Ubuntu 11.04 in detail: 1- Dependencies using this command Install: sudo apt-get install xutils-dev libpciaccess-dev Mesa Library requires libdrm version> = 2.4.24 which is not available in the Ubuntu 11.04 repository (x11proto-dri2 -dev x11proto-gl- dev-libxdamage-dev, libxfixes-dev 2-old version is available) then you have to download the source and it will be created using the following commands To do this: 3-download to make the compile it and then compile it using the following commands: config.configure Installing linux-fbdev sudo to create realclean to create --prefix = install_directory be care

I am new to theory: there is a problem with the sorting of records I have recorded. A sample. I have a paragraph model that is related to source model 1 & lt; -> n is a property of a model model called 'integer value'. Now I want to get an article with it, on the basis of which Ardidase My DQL looks like this: $ q = Doctorin_clair :: Creating () - & gt; ('A.title, s.content') -> from ('paragraph A') - & gt; Left zone ('a.Source s') - & gt; Where ('a.id =?') - & gt; Order By ('S.' ''); Post-text "itemprop =" text "> Hmmm ... should do it. Probably try one of these: -> Order by ('S.Sho DESC') -> Order By ( 'S.ASC')

Can someone direct me to a link or something where I can get the most efficient paging? this is an old question see Are you looking for this?

Windows Mobile is trying to get a thread to change form controls. Throws an unsupported exception. / P> Does this mean it can not be done at all? If not, how do I know about it? If the form is made in the original / main thread, then a thread is created to do some work in the background, but I want to make it so that it can update the background thread to update the form ... < / Div> You can not access GUI items on the non-GUI thread. You will need to determine whether a charge is required for the GUI thread. For example (here's something I did before): Public Representative Zero SetEnabledStateCallBack (Control Control, Boole Enabled); Public Static Zero SetEnabledState (Control Control, Bowl Enabled) {If (control.InvokeRequired) {SetEnabledStateCallBack D = New SetEnabledStateCallBack (SetEnabledState); Control.Invoke (D, New Object [] {Control, Enabled}); } Else {control.Enabled = enabled; }} or Public Rep Zero AddListViewItemCallBack (ListView Con

कृपया मेवेन के साथ findbugs को एकीकृत करने के लिए कदम प्रदान करें मैवेन खोजबग्स प्लगइन का उपयोग करें। उदाहरण के लिए प्लगइन देखें।

I'm looking for the best method for the following problem. I currently have a large number of objects that are inheritors for all the same base objects and all are very similar. Is there a solution available, allowing anyone to take action and edit the action without the need to repeat the same code. For example, I may have an individual object: public class PersonBase {public string first name {get; Set; } Public String LastName {get; Set; }} And then I will have several objects that come from person : public class salesperson: PersonBase {Public Double Total Tanning {Received; Set; }} Public class customer: Personbase {public string address {get; Set; }} Now I have a task that will create a customer base: [http post] Create public virtual actionless (formulation collection) { Var person = new personality (); UpdateModel (person); If (Model.IsValid & amp; amp; person. ISI Walid) {// Save to the db} Return View (); } Now I can easily copy this code an

How can I add a background image to a UILabel in an iPhone app? I tried to do it through IB but no results. Can someone help me .. Your answer is moving forward. Try it with code: Objective- C: theLabel.backgroundColor = [UIColor colorWithPatternImage: [UIImage imageNamed: @ "Blah"]]; Swift: thelabel.backgroundColor = UIColor (Pattern Image: UIImage (named: "blah")! ) or a UIImageView behind the label (not recommended). Update: Keeping a UIImageView behind a label was not recommended because you have to manage two ideas. But if you have to do something which only a UIImageView can do it is still a good way, I doubt that your app will actually move like this better.

I have a .cb file that runs on the Windows CE box as part of the installer process. Has been written in As part of the upgrade process, the CAB file runs twice, but at different locations at different times Which directory is the CAB file using the C ++ file (executing the directory)? Thanks If "C ++ only" means you mean Without using the Windows API, I do not think the Standard Library has to do this. If you can call the Win32 API, you must call GetModuleFileName () with the tap as the first code, and you will receive the path of the present executable. Now, the problem is: do you run CAB, what is executable? CAB, or DLL to be withdrawn from shell components, is running the CAB? You can also try GetCommandLine () , because the first entry should be executable path / name (it actually sent to CreateProcess () Gone string, so you can not make sure about it 100%).

I am trying to use a spring to put an SFL 4J timber in such a square: @Component public class example {private finals logger logger; @ Owned Public Example (Last Logger Logger) {this.logger = Logger; }} I have found the factory bean class, which I have implemented but the problem is that I can not find any information about the injection goal: Public class loggingfreebenben factory factory bean & lt; Logger & gt; {@ Override public class & lt ;? & Gt; GetObjectType () {Logistar. category; } @ Override Public Boolean is Sissington () {return false; } @ Override Public Logger getObject () throws an exception {return LoggerFactory.getLogger (* * How do I get a hold of the target class here (e.g., class)?) /); }} Is Factory Bean the Right Way? When using Picocontainers, you get the type of the target you received. This is a little bit in the invoice. But how do you complete it in the spring? Here is an alternative to your solution: BeanFactoryPost

I would like to install my dragon application as a command line tool that should work inside the fully installed directory (for example C: Thank you Not sure that this is what you are doing but This can be done by doing this. import os dir_of_current_module = os.path.dirname (__ file__) Once you know the deer, you have to do it chdir () Or what you want. Remember: you are not always allowed to give up stuff.

In my eclipse project, I am using a third-party annotation processor to be precise. The annotation processor works as expected and specifies the files generated by Java. These files are generated in the directory of the eclipse project under the "normal" folder, in the project properties, it is correctly displayed because there are two source folders - "src" and "gen." However, when the project is created for some reason, then all [generated] sources are not compiled under "people" (check the "bin" directory; I only see square files from the "source" directory ). Does anyone know why this is happening? I thought a while ago and thought that I will come back and explain what happens when the compiler runs So it compiles the existing sources (which I wrote) and then generates source files from the existing source files but it does not compile these generated sections. I will call it an ant project (according to setup) C

I have a page where 117 input fields are what I want them to submit through Jquery AJAX What do I do? Thinking, creating an array and sending them in such a way. I would like to ask that it is possible to take all the inputs and then put them in an array and then recover them from php files . (For example, should I explode, or for each..atc ??) Input fields are not in one form (only in the div with id = "config") Thanks. Why not use an Ajax Post? In PHP, they will all be accessible through the 'superglobal' array.

I have some websites I created earlier, which uses jquery mouse events ... just one The iPad has been found and I have seen that all mouse clicks on events are translated into ... so for example I have to do two clicks instead of one. (Hover before actual click) There Is there any remedy ready to solve this? Maybe that's a jquery command I used shoudl instead of mouseover / etc. Thanks! No, it has been thoroughly tested, but since the events that touch the iOS, these You can work, assuming that you are in a jQuery setting. $ ('a'). ('Click touchend', function (e) {Var el = $ (this); var link = el.attr ('href'); window.location = link;}); The idea is that mobile webkit is touched by a at the end of a tap causes the incident to fire, so we listen to that and Then as soon as touched event has been removed from a link.

I'm having trouble writing my market plug-in. I'm trying something different things, and this is the current state of my file: 'BZR plugins' from 'bzrlib.commands' command , Register_command import version_info = (0,0,1, 'Dev') class cmd_test_foo (command): '' 'test is painful' 'Def defaced (self): Print "Hello" register_command (cmd_test_foo) < / Pre> Here's what happens when I try to execute my order: $ BzR test foo Hi BzR: Error: Unknown command "test foo" so that really Ib - it clearly is going my order, but tells me it is unknown builtins.py but have suggested but nothing was helping. Since I did not get any real information about this error on the web or so on, I decided I should post and answer my only question. The market imports a plugin when it creates an .pyc file importing normally from Python if something is magical - like editing in a directory and forget to copy i

I am creating a WordPress blog (There is no live link yet because it is still in a planning stage) / P> Category 2: Customer Type Tags: Small Business, Large Companies Therefore each post will be tagged with one tag from category 1 and one tag from category 2. However, I have heard that using more than one category is a bad idea in terms of SEO per post? But then, how can I go about it? I do not want any SEO penalties, but I have to categorize each post using these 2 different categories. Should I Make Some Custom Taxonomy? It seems that there is a novel for me. The solution is probably not easy, but it only escapes me. I do not have much experience with taxonomies, so I appreciate any suggestions. I agree, an alternative we share and archive To create a secondary template for Php vs. defaults, which also applies non-index, follow the meta instruction. In this way, if the link has been created in indexed pages, then they pass their link flows back to the primary permal

New car ("Buick", 1932), new car ("Ford", 1932), car [] array = New = "New", "Ford", 1992), New Car ("Fiat", 1988) Car [] New Car ("Dodge", 1999), New Car ("Honda", 1977)}; I tried to do something like this: for (int i = 0; i & lt; dtable.Rows.Count; i ++ ) {DataRow drow = dtable .Rows [i]; Arrangement [] = New car (Draw ["Make"]. Toasting (), Draw ["Year"]. Toasting ()); } How do I add additional data to the array while looping through a dataset? UPDATE1: I went with the solution proposed by @ Roy. // Create array, car length [] arrayOfCars = specify new car [dtable.Rows.Count]; {Detroau Draw = DeBel. For Intuit = 0; I & lt; dtable.Rows.Count; i ++) ROS [I]; // Assign a specific index to each car within the array (arrayoffers [i]) array of cars [ii] = new car (draw ["make"]. Toasting (), draw ["year"]. ); } Once created, you can no

I am trying to duplicate an existing DNN portal in which the duplicate of the database is created and repeated by me Is near for testing purposes. Pure files in a new folder After I copied the site and changed WebCom to point to the new site and changed the alias to the database, I am getting this error This webpage has a redirect loop. The webpage here has resulted in a lot of redirection. Clearing your cookies for this site or allowing third-party cookies may fix the problem. If not, this is probably a server configuration problem and there is no problem in your computer. Here is a list for the DN Redirect Loops: 1 ) You are setting the middle of the trust level and using version 1.0.61025.0 of System.Web.Extensions. Complete and update trust level System for 3.5.0.0 in Web.config. Update all versions of the web (suppose that .NET 3.5 framework is installed). Basic: & lt; Trust level = "medium" ... ... ... system. Web. Extension, Version = 1.0.6

I asked before and the way I should be I have a simple app that has three The tables are users, robots, and recipients are members of robots and the recipients belong to robots. On the robot show page, I want to be able to create recipients for that robot inside the robot show page. I have the following code in robot show page that lists present recipients: & Lt; B & gt; & Lt;% = h Recipient.watch_skrine_name% & gt; & Lt; / B & gt; By & lt;% = h Recipient.prologic_name & lt; / Td> & Lt; Td> & Lt;% = link_to 'edit', edit_recipient_path (recipient)%> & Amp; Nbsp; & Lt; / Td> & Lt; Td> & Lt;% = link_to 'Delete', recipient ,: confirmation = & gt; 'Are you sure?' ,: method = & gt; :% & Gt; & Lt; / Td> & Lt; / TR & gt; & Lt;% end% & gt; & Lt; / Table & gt; And now I have this robot in the show view: <% form_for (rerecipient) do | F |

मेरे पास निम्न के जैसा टेबल है: वर्ष | उत्पाद | मान 2006 ए 10 2006 बी 20 2006 सी 30 2007 ए 40 2007 बी 50 2007 सी 60 मुझे एक ऐसा प्रश्न चाहिए जो निम्नलिखित तुलना वापस करेगा उत्पाद | 2006 मान | 2007 मूल्य ए 10 40 बी 20 50 सी 30 60 ऐसा करने के लिए क्या विकल्प हैं? क्या यह जुड़ने के बिना किया जा सकता है? मैं डीबी 2 के साथ काम कर रहा हूं, लेकिन सभी एसक्यूएल प्रकारों में उत्तर उपयोगी होगा। उत्पाद का चयन करें, मैक्स (जब वर्ष = 2006 फिर वैल्यू अंत) [2006 मान] के रूप में, अधिकतम (मामला जब वर्ष = 2007 फिर वैल्यू अंत) उत्पाद द्वारा उत्पाद ऑर्डर के अनुसार MyTable समूह

I am trying to declare the size of a four array and I need to use the variable value Size_t to declare a shape, can I extract the size_t variable in a shape so that I can do that? size_t is an integer type and no one is necessary. In C ++, if you want the dynamic size array, then you dynamic allocation using new . That is, you can not use it: std :: size_t sz = 42; Four carre [sj]; You need to use the following instead: std :: size_t sz = 42; Char * carray = new char [sz]; // ... and later, when you are done with the array ... Delete [] Cairo; Or, preferably, you can explicitly delete std :: vector ( std :: vector ) There is no need to remember and you do not have to worry about many proprietary problems that come with manual dynamic allocation): std :: size_t sz = 42; Std :: vector & lt; Four & gt; Cvector (SZ);

क्या किसी को rightBarButtonItem को UINavigationController को छुपाने का तरीका पता है? मेरे आवेदन में, मेरे पास rightBarButtonItem जैसा एक UINavigationController के रूप में एक संपादन बटन है मैं यह छिपाना चाहता हूँ? जब कुछ ऑपरेशन किए जाते हैं तो UIBarButton। दायाँ बटन छुपाएं: self.navigationItem RightBarButtonItem = nil; अब, इसे दिखाने के लिए: यदि आप अपने दृश्य नियंत्रक को स्वयं को निर्दिष्ट करके सही बटन सेट करते हैं EditButtonItem तो इसे दिखाने के लिए बस इसे फिर से असाइन करें: self.navigationItem.rightBarButtonItem = self.editButtonItem; यदि आप सही बटन को सेटअप करते हैं एक UIBarButtonItem आवंटन और उसे आवंटित करके अपने दृश्य नियंत्रक, तो बस अपने दृश्य नियंत्रक में UIBarButtonItem के संदर्भ को रखें, और उसे इसे दिखाने के लिए पुन: निर्दिष्ट करें।

I do not think so and I think it should be easy. Rails on Rails, How do I: 2010-06-14 19:01:00 UTC and turn it on < B> Can not I just use an assistant in the scene?

Can anyone know that it is possible to touch the ELLEPS or Netbeans in its bare core (project tree + code window) and Run it as an applet in the browser? How to appreciate the signal. PS: This is for a simple online IDE About eclipse , I do not think this has been done. If this is possible, then by using the (Rich Ajax Platform), which is to run existing RCP applications only as web applications with small changes. The actual project viewer and the code editor will have real work to integrate features.

I have to create a textbox (WPF) to enter time with verification, for one time (6:12) I want to enter regular expression verification. Check this: handling verification errors in control Or you can see your Voododal So that Validation is embedded for your data itself.

I am using Infinitist for continuous testing while developing Java and when I do .NET C # & amp; How to test continuously? .NET? EDIT: I am not looking for continuous integration, such as cruise control, teamcity etc. This is an immediate feedback tool that works with your IDE that I will be able to do for if you If using Visual Studio 2008 or 2010, you should take a look at the detail. Note that when you save, do not test on every build.

I just came to know that our MSDN incorporates licensing premiums, and I establish a business. Can I just install a premium on the business, or do I uninstall and reinstall everything? I am not safe from being installed on the top of the professional because I have already established Adin and the configuration. I came to some point and needed to upgrade from Visual Studio 2010 Professional to Visual Studio 2010 Premium Was there. I have just installed Visual Studio 2010 Premium on Visual Studio 2010 Professional Edition. All worked without; 0) I needed to restore my VS add-ins and service pack (such as seriallight 4 tools) and point to my original settings file, but all this Was there. It seems that most or all of my extensions stay in place.

Our site has a simple menu structure depending on the 2 column stack of menu elements on the floating device. Unfortunately, it seems that most of the BlackBerry phones wrap all the elements over the other? Any suggestions. Check it out that works beautifully on most mobile devices including the iPhone. The Blackberry Browser is extremely poor due to lack of full CSS support, especially on older models. You may have to experiment with other ways to achieve whatever you want, like using a table-based layout.

I have to change all the white (ISH) pixels in a PNG image with alpha transparency. I am using Python in APENGen and there is no access to such libraries like PIL, ImageMagk etc. AppAngine has an image library, but it is mainly placed in image resizing. To open a small and managed little function that I need: The pseudo-code for the main loop would be something like this: Pixel for each: If the pixel looks "quite white": otherwise set the pixel value to make transparent: keep the existing pixel values ​​and ("assuming 8bit values") will be "quite white" : Where every R, ​​G, B value is greater than "240" and every R, ​​G, B value is This is the first of all "20" within This is the first time I have given time to work with raw pixel data like this, and though it works, it performs very poorly It seems that in this way there should be a more efficient way of processing any data on every pixel? (Matrix?) I was hoping

I have a list of 350 rpms listed in the text file which is installed in a cluster which is not online outside of the world . We have an internal yum repository, a way to get the list, and download it for yum to get back to the cluster to install all 350? I hate thinking of downloading them one by one. Thanks Reposing and making internal repos (and then using kickstart) Better option, IMO But if you just want to download, then something simple: yumdownloader $ (cat myfile) ... this is well Can do. Yumdownloader is in yum-utils package if you need to use yum / yum-downloadonly so you can: yum --installroot = / tmp / my-installroot - download Just $ (cat myfile) ... which will also get you all the dinners (make sure if you want to do that) If this does not fit on the command then use the yum shell: perl -pe 's / ^ / install /' myfile & gt; Run myfile-shell echo & gt; & Gt; Myfile-shell yum --installroot = / tmp / my-installroot --downloadonly

I have read a lot of books about programming for SharePoint 2007, but * in reading these books, and referring to the online MSDN document, Is there a book about SharePoint 2007 API that discusses deeper in everything ? ? I think Microsoft will ship / ship this kind of book? :) * I have found "SharePoint 2007 development dishes - a problem solution approach" by the appress, but I think it hardly scratches the surface of the API. Look at this book with great fortune, it is not guaranteed. It's all that happens, but it's mostly developer resources ...

After I am communicating with a flash application using an order like the following: ExternalInterface.call ("Hello" "World") This is controlled by something like the C # end: string swfPath = Directory.GetCurrentDirectory () + Path.DirectorySeparatorChar + "test. Swf "; This.axFlash.LoadMovie (1, SWFPath); This.axFlash.FlashCall + = New AxShockwaveFlashObjects._IShockwaveFlashEvents_FlashCallEventHandler (axFlash_FlashCall); Also as a function is declared zero axFlash_FlashCall (object sender, AxShockwaveFlashObjects._IShockwaveFlashEvents_FlashCallEvent E) {} axFlash_FlashCal is called OK, as long as the screen that is set to use the TLF text is as a text box. (Any text box, no specific ID) Without a text box, there will be no fire (though ExternalInterface.Avaliable is set to true) I use CS4 and CS5 to publish, using both flash as output 10 and 9 have tried. None of these things made a difference. I am using AS3 and .NET 4.0. Has a

I was telling my application to call two dll these two DLS from other groups and other companies have read a little about the managed and unmanaged I would like to call managed calls. But is managed or unmanaged use only a decision to call or it also depends on Cali? All DLLs can be called with managed code? If the colt is also a factor, how will I know that this DLL can be called with managed code? If DLL is written in the managed code, it will be a managed call. Otherwise you will have to do an unmanaged call. Manage both parts to be a managed call.

I am trying to find results of a model where it inquires as a result of two situations I have a search tag that Model.find (: all,: conditions => parameter like "Name [search]") But I want to find all the records for the search where the parameter like [search] or description is the name of the [search] name. Is there a way or someone Adding to the condition in the rail? Should I make a statement? rail For 2.x, you can use this query, which is a SQL injection The attacks are not weak: Model.all (: conditions => ["Like the name? Or as the description?", "% # { / div>

I have problems with applying the rich text editor (all that I have tried to do, eg TinyMCE). I tried many tutorials and articles but all were the same. When I'm trying, I get the best job working in IE (8), but not another browser (Opera, FF, Chrome). Download the samples that I work fine in all browsers I like VS2010 asp.NET MVC2 and eg. I tried this thanks for help I used the following ViewUserControl & lt;% @ Control Language = "C #" Inheritance = "System web.mvc.WUUSUSR controller & gt; dynamic & gt;" & Gt%; & Lt; Script type = "text / javascript" & gt; , "Safari, spell-checker:" articleBody "subject: // Note that the editor text field ({Elements articleBody tinyMCE.init should be an id" advanced ", mode:" exact ", height:" 300 ", plugins Pagebreak, autosave, table, advimage, iespell, inlinepopups, paste, nonbreaking, template, full screen, paste ", theme_advanc

मेरे पास इनपुट चेकबॉक्स है ऐसा कुछ .. & lt; input class = "inputchbox "Id =" Pchk "प्रकार =" चेकबॉक्स "नाम =" चेक "मान =" & lt;% = Model.ID% & gt; " / & Gt; जावास्क्रिप्ट का उपयोग करने के लिए मुझे सभी चेकबॉक्स को सरणी में आईडी का पता होना चाहिए? मुझे कैसे प्राप्त करने की आवश्यकता है? धन्यवाद < / P> शुद्ध जावास्क्रिप्ट उत्तर var formelements = Document.forms ["आपके फ़ॉर्म का नाम"] तत्व; Var चेकएलेमेंट्स = नए अर्रे (); (Var i = 0, element; element = formelements [i]; i ++) {if (element.type == "चेकबॉक्स" & amp; amp; amp; & amp; element.checked) [checkedElements.push (तत्व); }} Jquery उत्तर $ ("इनपुट: चेक")

I am trying to divide the nucleotide sequence into amino acid strings using a regular expression. I have to start a new string in every incident of string "ATG", but I do not really want to stop the first match on "ATG". There is no order of a string of valid inputs S, CS, GS, and SS. For example, the input string has been given: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGAGTCA (full point) and ATGAGATCA (Next of the first match of "ATG") a string in which "ATG" should be the result of N bar, not result. I thought that expression / (?: [ACGT] *) (ATG) [ACGT] * / G will work, but it does not work. If it can not be done with a regexp, then just writing the code is quite easy, but I always like an elegant solution if someone is available. If you really want to use regular expressions, try: var str = "ATGAACATAGGACATGAGGTCA" , Again = /ATG.* / g, matches, matches = []; while ((match = re.xac!)! == faucet

I tried to use a free script found on the internet but it is giving me problems with Windows users (even if They are using IE 8, so I do not have the option to ask them to upgrade their browser.) Here are the requirements: I have Microsoft Word and PDF files There is a group that needs to be protected The authorized users can download them. I have already created the login system and the existing script, which I have worked well for non-IE browsers. However, I keep recurring problems with Windows users who complain that their files corrupt and so far everyone is using Mac or Linux or any other browser, just fine. The script should allow me to store files in the directory, but the function forces the file to download the file. Should work well with most major browsers, especially IE if you have any suggestions or know about any great scripts ( Even if they have been paid, I am sick of this problem and will probably pay for a payment script) It will be highly appreciated in

I am compressing a string using gzip, then uncompress the result, but I got the following exception, Why? Output: Exception in thread "main": java.util.zip.ZipException: javas.util.zip.InflaterInputStream.reads overbased dynamic bit length tree (Unknown source) source at Java.util.zip.GZIPInputStream.read (test.java:25) public level test {public static zero main (string [] args throws IOException { String s = "helloworldthisisatestandtestonlydsafsdafdsfdsafdsfdsfsdfdsfdsfdsfdsfdsfdasfassfdfdsfdsdssdfdsfdsfd"; Byte [] bs = s.getBytes (); Bytereon OutputStream Outstream = New Bytereanputstream (); GZIPOutputStream gzipOut = new GZIPOutputStream (outward); GzipOut.write (bs); GzipOut.finish (); String Out = Outstream.string (); Println (outside); Println (out.length ()); ByteArrayInputStream = New Bytereinputstream (out.getBytes ()); GZIP InputStream gzipIn = new GZIP InputStream (in); Byte [] uncompressed = new byte [100000]; Int len ​​= 10, offset = 0, total

Is there any way to decide what your available bandwidth should be on EC2? The documentation indicates that it should be based on your instance size, but I am having trouble finding a specific number. This is based on the size of your installation and can only be available for # for XL Was there. It is believed that they should get 300-350 Mbps.

I have such code (all the uses shown): bool = false ; For (int i = 0; i & lt; large; i ++) {... for (int j = 0; j & lt; wah; j ++) {... if (foo (i, J)) {done = true; break; } ...} if (done) break; ...} Any compiler will convert it to: for (int i = 0; i Note: When I'm most interested in the break (if done); is removed as a bypass and dead code, I am also interested in that if more done is removed completely. Obviously it depends on the compiler. When you are unsure, the best thing to do is to look at the compiler's assembly output (all popular compilers are a switch for this). Even if you are not familiar with the assembly, you can compare the debug version with the least customized version. It is being said, This is one of the few situations where goto is not a bad idea to use it to break the internal loops Feel free to Edit The following attempts have been made in VS2010 and it actually optimizes external conditional: Bool done

I have a html handler which changes the size of images based on quickstring, so make such a request: I have given my handler's path to * .jpg, * .gif, * .bmp, * .png Mapped in the form. However, this does not activate the handler if I only make it *. Jpg , then it works. My question is, do I have to create 4 different mapping entries, one for each image type, or what is a way to combine multiple extensions in one way? Daniel T's answer: handler mapping of IIS 7 IIS 7 handler Mapping is different. In IIS 6, you can map your controller to web.config : & lt; Configuration & gt; & Lt; System.web & gt; & Lt; HttpHandlers & gt; & Lt; Verb = "gET" path = "* .jpg, * .gif, * .bmp, * .png" type = "YourProject.ImageHandler" /> & Lt; / HttpHandlers & gt; & Lt; /system.web> & Lt; / Configuration & gt; This allows you to use multiple routes, comma-delimited. In IIS 7

I am creating a web app's users to write their own CSS to customize their profiles. Page. However, I know about this security with many security risks, i.e. background: url ('javascript: alert ("your cookies are found!" + Document.cookies'). So, I am allowing CSS as much functionality as possible for my users, I am looking for a solution to clean CSS. So what are my questions that someone To understand this thing, a gem or plugin bar Do I know? I have already excluded my mind so any suggestions would be really appreciated! "post-text" itemprop = "text"> See in CSS Sanitizer & gt; Action Controller :: Base .helpers.sanitize_css ('background: #fff') = & gt; Background: #FFF; "Action Controller :: Base.holder. sanitize_css ('JavaScript: Alert (' '' '') = ' / Html>

Please tell me how to save and show the database of the retestbox and recover it in the saved format and save the datatype That data should be used for vb.net and my sql You can use datatype.

In Z, I am doing a new project and it needs to be drop down, which populates data from database (i.e. categories). I need to show the data for those categories shown in the Tree View in the drop-down menu. I have tried a little bit by getting the data from the database and then by using foreach and arranging it in jade END_FORM, put it in the value $ category-> AddMultiOption ($ childcategory ['category_title'], $ childcategory ['id']); But still I can not find the desired value in the form. Please suggest how to do this because I am very involved in the Zend Framework. A small code snippet will be very helpful in understanding. Thanks in advance. I'm not sure what you mean by the tree, but if you opt around the specific option -group, you can use the following multi-option structure: $ options = array ('option group name' = & gt; array ('value1' = & Gt; 'Label 1', 'value2' = & gt; 'label2',), &#

I get a compiler warning that I do not understand that context. When I compile "Child.cpp" with the following code (Do not wonder: I have stripped the declaration of my class from the minimum, so the content does not matter much, but you will see this problem sharp). I get a warning with the highest warning level. code AbstractClass.h: # include & lt; Iostream & gt; Template & lt; Typename T & gt; Class abstract claus {public: cancel virtual zeros (); // {std :: cout & lt; & Lt; "Cancel Abuse" & lt; & Lt; Std :: endl; }; Virtual Zero Process () = 0; }; // External Definition If I comment on this and take the definition of // above (currently commented), then I could not find a compiler warning // // Template & lt; Typename T & gt; Zero object class & lt; T & gt; :: Cancel () {std :: cout & lt; & Lt; "Cancel Abuse" & lt; & Lt; Std :: endl; } Child.h: #include "abstract

Here's my case ... I have a xxxxxx.java file when I'm composing the file to compile and run Get the output in. Java file ... but I need a yyyyyy.class file that means it should compile the output file automatically from the xxxxxx.java file and get yyyyyy.class ... it can be done in Java < / P> Thanks Since Java 6, this javax.tools < / Code> can be done through API.

I would have to create a handwritten document for a large system with all the things expected from telecommunications deployment: many servers, databases Clusters that copy some data between them in a specific way, for both tons of log files, off-shelf and locally developed software, scripts, network configuration, local address etc. It is actually a sysadmin-typical element, as a developer. The goal of this document is in sysadmins in the first place that meet day-to-day operational tasks and some problems are solved, and in the second place people who want to be in general about the system Learn about Is there some place that I can learn about writing something like this? It says "what is" a book about "all things telephony" as the "number can easily be a 10 page" 500 number. It may be that more than one document actually exists. Please link some useful resources / books that I can use for this purpose. PS: This is the only internal customer,

How can I add 30 seconds at this time? $ time = date ("m / d / y h: i: s", time ()); I was not sure how to do this because it is showing many units of time, when I want to add only 30 seconds. $ time = date ("m / d / yh: i: sa", time () + 30);

I have a working SMS receiver, but when I try to load another class: P> intended intent = new intent (SMSReceiver.This, SMSNotifier.class); StartActivityForResult (intent, 0); I get this error: Constructor intent (SMS receiver, class) is undefined before For line and: method startActivityForResult (intestine, int) for the second line type is SMSReceiver I Really appreciate some advice about what is going wrong. package com.prototype.messages; Import android.app.Notification; Import android.app.NotificationManager; Import android.app.PendingIntent; Import android.content.BroadcastReceiver; Import android.content.Context; Import android.content.Intent; Importroid.os.Bundle; Import android.telephony.gsm.SmsMessage; & Gt; Public class SMSReceiver expands Broadcast receiver {@ Override available on public blank (reference reference, intended intent) {bundle bundle = intent. SMS Message [] msgs = Null; String str = ""; If (bundle! = Null) {object []

I have written in an diff equivalent javascript which only gives relevant lines / prints Do not want the full text shown next to each other with highlighting the differences, but just the actual difference (and some buffer lines know where the difference is), is similar to the output from Linux deficiency. Does anyone know the JavaScript function that does this? All differences must be recognized (even the whitespace has been changed). Thank you. Inline mode comparison, try to tweak the reference size to display only the desired window,

I need to render a silverlight storyboard animation for the video. Animated content is the only simple UIElements running at the same time, Can be images or two or more videos. 1) I have never tested this against video embedded content Many thoughts came to mind like Renderitizet bitmap on a frame basis, but: 1) 2) The pictures produced do not actually know how to prepare the video. Expression Encoder is my mind, but I do not know what is expected of it, it is possible to integrate it into a Silverlight / XBAP app. What is your opinion on this? Your best bet is that if you need to capture this type of thing then Expression Encoder 4's Use of the screen recording facility, or tools like TechSmith Cametias.

In Sybase, an I / O data can be viewed by using the following: set stats on set xx this allows anyone to view the total logical I / O for a query without actually executing it. Is there a similar type of command for? The description of the explanation requires something from you (I'm afraid I have no real usage details) Or if you have access to it, explain the visual. Explain:

Using Java, how can I locate all the browsers installed on a system? you can not you Java 6 * With a default browser on any system you can open a page, but you can not list all the browsers installed on the system. Of course, you can use Windows' C: \ Program Files \ folder or * nick's / usr / local (Or other diaries), but you can run in user-privileged issues and you do not guarantee all browsers, nor does this OS free

I do not want to read serial port nor do I want to know other possible easy shortcuts: How to use C # in my laptop By reading a USB port. Whether you can suggest a site or explain the flow of the process, I would greatly appreciate your help If you want to develop for USB, January Acceleration (the author of USB Complete) is usually a good place to start Edit: Assume this is a hidden, whose You want to communicate with the article, it can be useful and may include C # samples May include.

I am trying to create an exact visual studio plan. For thisisanid) But now with the properties, the elements of brackets (id, class) also have blood color : (Ironically, this is a similar color here in Stokorovarflow). But I want them blue ( # 2902FC ) Example: Code sample: "Highlighting syntax hi comment guifg = # 777777 GUI = any hi todo guifg = # 8f8f8f GUI = any hi continuously guifg = # e5786d GUI = any hi string guifg = # 2902FC GUI = any hi identifier Guifg = # 2902FC GUI = any hi function guifg = # 9A1102 GUI = any hi type guifg = # EF2811 GUI = any hi statement guifg = # 9A1102 GUI = any hi keyword guifg = # 9A1102 GUI = Any Hi PreProc guifg = # 2902FC GUI = any hi number guifg = # 2902FC GUI = any hi special guifg = # 2902FC GUI = None "Hi below the question guifg = white GUI = Any question Hi Ctermfg = white period = any Hi modeMsg guifg = white GUI = any Is HTML bracket a way to target only target or CSS selectors? You have